Serotype Specific Sequences for Multi Test Line Nucleic Acid Lateral Flow Development

Hendarta, Narendra Yoga and Kusumawati, Asmarani and Aman, Abu Tholib and Wibawa, Tri (2021) Serotype Specific Sequences for Multi Test Line Nucleic Acid Lateral Flow Development. Serotype Specific Sequences for Multi Test Line Nucleic Acid Lateral Flow Development, 39 (3). pp. 207-215. ISSN 2407-3733

	Text artikel.pdf Download (629kB)
	Text Jurnal Complete.pdf Download (14MB)

Abstract

Dengue virus that agent of dengue fever and dengue shock syndrome has 4 different serotypes. Serotyping is needed for diagnosing and surveillance activities of disease spreads. Recently, the Nucleic Acid Lateral Flow (NALF) technique has been extended to confirm the results of easy amplification without complicated equipment. The aim of this study was designing capture probe for serotyping dengue virus (DENV) using NALF method. This study have conducted an analytical study to obtain four specific sequences of Dengue Virus serotypes to develop serotype specific NALF. Several parameters were used to analyzed Dengue genome sequences i.e. % GC content, target homology, length of 100% homology continue of non-specific bases, hybridization temperature, and secondary structure to estimate the probe’s capture capability in the hybridization reaction. The capture probes were applied to NALF and assayed using single strand DNA sample to check its performance. The result of four specific sequence capture probes, DENV1, 2, 3, 4 were CACCAGGGGAAGCTGTACCCTGGTGGT, GTGAGATGAAGCTGTAGTCTCACTGG, GCACTGAGGGAAGCTGTACCTCCTTGCA, AGCCAGGAGGAAGCTGTACTTCTGGTGG. Application to fabricated NALF gave no cross hybridization with high stringency buffer assay.

Item Type:	Article
Subjects:	Q Science > QR Microbiology > QR355 Virology
Divisions:	Poltekkes Kemenkes Yogyakarta > Jurusan Teknologi Laboratorium Medis > Program Studi DIII Teknologi Laboratorium
Depositing User:	PAK DOSEN 2020
Date Deposited:	06 Apr 2023 09:28
Last Modified:	06 Apr 2023 09:28
URI:	http://eprints.poltekkesjogja.ac.id/id/eprint/11947

Actions (login required)

View Item